Sequence comparison of the promoter region of Alphaviruses

The minimal sequence that functions as a promoter in Sindbis virus extends from nucleotide position -19 to +5 relative to the mRNA initiation site. Note the sequence conservation of the minimal promoter.

The sequence from about -40 to +14 is 3-6 fold more active than the minimal promoter. The precise sequences responsible for enhancing the activity of the minimal promoter remain to be determined.

                                                                |--> subgenomic mRNA
             -50       -40       -30       -20       -10       +1         +10
         :    |    :    |    :    |    :    |    :    |    :    |   :      |
nsP4 SerLysArgAlaPheGlnAlaIleArgGlyGluIleLysHisLeuTyrGlyGlyProLystrm
SIN  UCGUUUUCUCGUAAGGUUCGGUAGUCUCCCCUUUAUUUCGUAGAGAUGCCACCAGGAUUUAUCA  GUCGUAUCA    SINCG      J02363
A86  --------------A-------------------------------------------------  ---------    ACU38305   U38305
Gir  --------------A-------------------------------------------------  --------G    ACU38304   U38304
YN8  --------------A----------------------C--------------------------  ---------    AF103734   AF103734
OCK  ------G----------------U-----A----------------------------------  ---------    SINOCK82   M69205
XJ1  -------UAA-C--A--------A-----U-----------U----------------------  --------G    AF103728   AF103728
AUR  ---C-A-U------AU----UG-UG-G---UCGGG--CU--G---------------------U  -C-AC---G    AF126284   AF126284 S78478
SFV  CU--AA-UC--C--AU-CUUUA-C-----UGGAC-A-AU--G--------G----------A-C  ACGCA--U-    ALSFV42S   X04129
MBV  -UAA-AGUGUUA----C-GUAG-U-----UGGGC-A-AAC-G--------G-------------  ACGCAC-U-    MBVCP      J02246
BFV  -U-AAC-UCA-G---UC-UU---U------U--GG--AU-------------------------  ACG-C-AUC    BFU73745   U73745
RRV  ---GAC-UCUUA--AU--UUCG-CG-A--UGGG--GCAU--G--------G------------U  ACGUCUCUG    RRVNBCG    J02337
SAG  -UAAAC-UCA-A--AUCCUUU--U-----AGGG--G-AU-----C-----G------------U  ACGUCC-A-    AB032553   AB032553
ONN  ------CU-UUG--AU-CUUUG-U------GGGC-GCAUUGGA-C-----G--U---------C  A-GCGUGAU    ONNCG      M20303 M33999
IGB  --A---CU-UUG--AU--UUUG-U------GGGC-GCAUUGGA-C-----G--U---------C  A-GCGUAAU    AF079457   AF079457
SG6  ------CU-UUG--AU--UUUG-U------GGGC-GCAUUGGA-C--------U---------C  A-GCGUGAU    AF079456   AF079456
WEE  ---CAA-UCUUG---U-CUC---U------U-GGG--AGUGG--------GA-U---------C  ACU-C----    AF214040   AF214040 AF143811
EEE  AGUCAA--GUUG--AU--GU---U-----AG-GGGG-AUUGG--------GA-U---------C  AA-ACG-A-    EEEVIRNA   X63135 X67111
VEE  --ACAA-U-A-----UCGAU-G-C-------GGGGA-AUUG---------GAUU---C---C-U  -AU-CUGU-    EEVNSPENV  J04332
SPD  CU-AAC---A-C-U--AC-C-CGCG-------CAUGCAUAGG-------AGAUU---A----A-AA-A----GU-    SPA012631  AJ012631
SDV  CUAGAC---A-C-U-AAC-C-CGCG-------CAUGCAUAGG-------GGAUU---A----A-AA-A----GU-    SDI238578  AJ238578
                                             |- minimal promoter -|         
                        |------------------- full promoter ---------------------|

The sequences are those of:

SIN Sindbis AR8 Sindbis-like AR86 from South Africa, GIR Sindbis-like Girdwood from South Africa YN8 Sindbis-like YN87448 from SW China OCK Sindbis-like Ocklebo from Scandinavia XJ1 Xinjiang-160 BFV Barma Forest AUR Aura MID Middelburg RRV Ross River

SFV Semliki Forest ONN o'nyong nyong IGB o'nyong nyong-like Igbo Ora SG6 o'nyong nyong-like SG650 WEE western equine encephalitis EEE eastern equine encephalitis VEE Venezuelan equine encephalitis HJ Highland J SPD salmon pancreatic disease SDV rainbow trout sleeping disease