| (Return to Main) | Conserved cis-acting sequences of RNA viruses |
Single-stranded, ambisense, segmented RNA genome: large (L) and small (S) segments
Sequences shown here are those of the genomic minus-strand RNA
1. LCMV-LASV complex, or "Old World" arenavirus
e.g., lymphocytic choriomeningitis virus (LCM), Lassa (LAS), Mopeia virus
2. Tacaribe complex, or "New World" arenavirus
e.g., Junin (JUN), Machupo, Tacaribe (TAC), Pichinde (PIC) viruses
See: Auperin, et al., 1982; Auperin and McCormick, 1989
The minimal LCMV genomic promoter includes the 3' terminal 19 nt (Perez and de la Torre [2003])
L segment:
5' end Viral RNA 3' end 5 10 15 20 15 10 5 : | : | : | : LCM CGCACCGGGGAUCCUAGGCGAU.....GCCUAGGAUCCUCGGUGCG AF004519 AF004519 LAS -------------------AA-.....------------------- LVU73034 U73034 TAC ----------------------.....-----------A-U----- TACLSEG J04340 PIC ...------------------- PICLRNAA J02277
S segment:
5' end Viral RNA 3' end 5 10 15 20 15 10 5 : | : | : | : LCM -------------------U--.....-----------A-U----- LCVGPNP M20869 LAS G-------------------A--.....-----------A-U----- LSVNGPC J04324 PIC -------------------A-A.....-----------A-U----- PICSRNA K02734 JUN UG-AGUAA-------------G--.....-----------A-U----- JUNSRNA D10072 TAC ..-----------A-U----- TACNP M20304
e.g., LCM S segment
5 10 15 20 : | : | LCM CGCACCGGGGAUCCUAGGCUUUUUGGAUUGCGCUUUCCUCUAGAUCAACU_____ ||||| | ||||||||||| ||| : :||: || || ||| | ) GCGUGUCACCUAGGAUCCGUAAACUAACGCGUAAACAGAACUCUUUGGUA-----
Probably involved in termination of ambisense mRNA transcription.
| (Return to Main) | Conserved cis-acting sequences of RNA viruses |
| Send suggestions and comments to: huang@borcim.wustl.edu Henry V. Huang Department of Molecular Microbiology, Box 8230 Washington University School of Medicine St. Louis, MO 63110-1093 USA | Tel 314-362-2755 FAX 314-362-1232 | |